NFI ontwikkelt nieuwe internationale standaard voor DNA-naamgeving

Het Nederlands Forensisch Instituut (NFI) heeft software ontwikkeld om alle verschillende DNA-fragmenten, die met de nieuwste technieken bepaald worden, overal ter wereld dezelfde uniforme naam te geven. Nu gebruiken verschillende landen bij het weergeven van die resultaten van de nieuwste technieken nog verschillende namen voor dezelfde DNA-fragmenten. Dit maakt internationale vergelijkingen van DNA-profielen en uitwisseling ingewikkelder. Het internationaal opsporen van criminelen daarmee dus ook. “De software van het NFI kan een einde maken aan jarenlange Babylonische spraakverwarring,” aldus Jerry Hoogenboom van het NFI.

Al jarenlang wordt er wereldwijd door diverse onderzoeksgroepen en organisaties aan een oplossing gewerkt. Het is het researchteam van de divisie Biologische Sporen van het NFI nu gelukt om met een oplossing te komen voor uniforme naamgeving. De nieuwe methode wordt ‘STRNaming’ genoemd. Een wetenschappelijke publicatie over de ontwikkeling van de software door het NFI is gepubliceerd in het internationale tijdschrift ‘Forensic Science International: Genetics’. 

DNA-onderzoek

Nieuwe technieken maken meer mogelijk

Bij het huidige forensisch DNA-onderzoek wordt de lengte van DNA-fragmenten gemeten. Hiervoor bestaat al jarenlang internationale consensus over de naamgeving met uniforme weergave in getallencodes. De lengtes van de fragmenten zijn onderscheidend voor personen.

Sinds de komst van nieuwe technieken zoals Massively Parallel Sequencing (MPS) is het mogelijk om ook de precieze bouwsteenvolgorde van de DNA-fragmenten te bepalen. Een DNA-profiel dat gemaakt is met de nieuwe MPS-techniek is nóg specifieker. De samenstelling op DNA-bouwsteenniveau  geeft meer inzicht en informatie bij minimale of complexe sporen, met bijvoorbeeld DNA van verschillende personen, waarbij ook nog sprake kan zijn van verwantschap. De bouwsteenvolgorde worden met letters (A, T, C en G) weergegeven. Het resultaat van MPS-onderzoek is een DNA-profiel met fragmenten van elk vele honderden letters. Om die inzichtelijk te maken, worden er verkorte namen aan gegeven. Er bestond nog geen uniforme methode om informatie over de bouwsteenvolgorde op te nemen in de naamgeving.

Krakau

Daar moest verandering in komen, werd ruim vijf jaar geleden besloten tijdens het jaarlijkse congres van de internationale gemeenschap van forensische DNA-wetenschappers (ISFG) in het Poolse Krakau.  De verschillende naamgeving maakte het internationaal uitwisselen van DNA-sporen onnodig ingewikkelder, aldus onderzoeker Kris van der Gaag van het NFI: “Criminelen stoppen ook niet bij de landsgrenzen, dus dit werd gezien als een onnodige hindernis. Uitwisseling van data en internationale vergelijking werd bemoeilijkt doordat de MPS-DNA-profielen niet eenduidig werden weergegeven. Het makkelijkste is dat we allemaal dezelfde taal spreken. Dus door dezelfde namen te gebruiken voor de met MPS verkregen DNA-profielen.” Van der Gaag was namens het NFI een van de deelnemers aan het congres. Na het congres werden potentiële mogelijkheden geïnventariseerd, maar een internationale oplossing liet op zich wachten. Twee jaar geleden heeft het NFI aangeboden software te ontwikkelen voor het genereren van internationale namen.

Ingewikkeld

Waarom was het zo ingewikkeld om goede, universele namen te bedenken voor de met MPS verkregen DNA-bouwsteenvolgordes? Om DNA-sporen te kunnen analyseren en eventueel te vergelijken, moet het MPS-DNA-profiel inzichtelijk worden gemaakt,” legt Jerry Hoogenboom uit. Hoogenboom ontwikkelde de software voor de naamgeving. “Voor zo’n profiel analyseren we stukken DNA van soms enkele honderden bouwstenen, die we weergeven in de letters A, T, C en G. Die bouwstenen staan vaak in een bepaalde, zich steeds herhalende volgorde. Maar die volgorde kan om de zo veel herhalingen veranderen, dat maakt het ingewikkeld. Om deze bouwsteenvolgordes leesbaar en inzichtelijk te maken, wordt aan de lettercodes een naam gegeven. Op deze manier zijn ze niet door alleen computers te lezen, maar ook door DNA-deskundigen te interpreteren.” 

Nieuwe namen

In 2019 werd onder de deelnemers van het ISFG-congres in Praag een enquête gehouden om de wensen en voorkeuren voor uniforme namen te inventariseren. “De voorkeur was vooral: houd het zo simpel mogelijk, maar probeer wel zo veel mogelijk informatie weer te geven,” vertelt Hoogenboom. Hij bouwde de softwaretool zo, dat die zo veel als mogelijk tegemoet kon komen aan alle wensen en voorkeuren voor de namen. Het schrijven van de software heeft twee jaar geduurd: “De grote lijnen waren al na een jaar klaar. Sommige zich herhalende bouwsteenvolgordes waren echter erg ingewikkeld, waardoor het programma traag werd. We hebben allerlei bewerkingen moeten doen om de naamgeving door de computer sneller te laten verlopen.” Met het softwareprogramma krijgen alle verschillende DNA-bouwsteenvolgordes een naam van gemiddeld zo’n 35 tekens. Die tekens zijn de letters van de bouwstenen en de getallen geven aan hoe vaak een bepaalde herhaling voorkomt. De bouwsteenvolgorde TATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCAATCAATCATCTATCTATCT wordt door de software geanalyseerd en weergegeven als CE12_TATC[12]AATC[2]ATCT[3]. Want  de combinatie TATC komt 12 keer voor, AATC 2 keer en ATCT 3 keer. “Het zijn geen heel prettige namen om uit te spreken, maar je kan ze als mens wel overzien en dicteren”, aldus Hoogenboom.

Open source

Het NFI stelt de nieuwe methode van STRNaming kosteloos en open-source ter beschikking aan de internationale forensische gemeenschap. Vorige week was de eerste bijeenkomst van een internationale commissie met vooraanstaande biologische wetenschappers uit in totaal negen landen met als doel om tot een uniforme naamgeving te komen. Het NFI levert hieraan met deze software een belangrijke bijdrage. “Het draagt eraan bij dat het forensisch DNA-onderzoek in Nederland op de internationale kaart staat,” aldus Van der Gaag. In de afgelopen jaren ontwikkelde het NFI ook al andere software voor forensisch DNA-onderzoek. Denk hierbij bijvoorbeeld aan DNAxs voor het interpreteren en vergelijken van DNA-profielen, de statistische rekenprogramma’s LRmixStudio, DNAStatistX en MixCal voor het berekenen van de bewijskracht van een overeenkomst tussen het DNA-profiel van een persoon met dat van een spoor, en SmartRank voor het slim doorzoeken van de nationale DNA-databank. Die software wordt inmiddels ook door andere landen gebruikt. Van der Gaag: “De naamgeving is weer een stap in een ontwikkeling die bijdraagt aan nieuwe mogelijkheden van DNA-onderzoek, die wellicht tot doorbraken kan leiden in ernstige strafzaken.”